The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1635
Genome IDCP000254
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanospirillum hungatei JF-1 [CP000254]
Start position on genome 2765339
End posion on genome 2765265
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
atccactttt
tRNA gene sequence
AGCGAGGTGGGGTAGTCAGGATATCCCGACGGGCTCATAACCCGTAGACCGATGGTTCAA
ATCCATCCCTCGCTAtac
Downstream region at tRNA end position
ttcttttcag
Secondary structure (Cloverleaf model)
>At1635	Met	CAT
                   t      Atac ttcttttcag
                     A - T
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T A C C     A
    C T G A        G      | | | | |     A
  A         T G G G       G A T G G     C
  G           | | |                 T T
  G         T C C C
    A T A          G     AGACC
                    A - T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(initiator).
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK