| Sequence ID | >WENV170779152 |
| Genome ID | LZCG01002291 |
| Phylum/Class | [LZCG] oil field metagenome; sample BH-FW-1 from oil reservoir |
| Species | |
| Start position on genome | 402 |
| End posion on genome | 474 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
catccatgct |
| tRNA gene sequence |
GCCGCCGTGGCTCAGCTGGCAGAGCGGGTGACTTGTAATCACCAGGTCGCGGGTTCAAAT |
| Downstream region at tRNA end position |
ctgataattt |
| Secondary structure (Cloverleaf model) | >WENV170779152 Thr TGT
t Tttc ctgataattt
G - C
C - G
C - G
G - C
C - G
C - G
G - C T A
T C G C C C A
C G A G | | | | | A
T C T C G G C G G G C
G | | | | T T
G G A G C
C A G AGGTC
G - C
G - C
T - A
G - C
A - T
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |