Sequence ID | >WENV170784050 |
Genome ID | MCHG01000004 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 456856 |
End posion on genome | 456931 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ctccgcgatt |
tRNA gene sequence |
GGCCCCGTTGTGTAGCGGCCTAGCACGCCGCCCTCTCAAGGCGGTAGCGGGGGTTCGAAT |
Downstream region at tRNA end position |
aaagcgcccg |
Secondary structure (Cloverleaf model) | >WENV170784050 Glu CTC t ACCA aaagcgcccg G + T G - C C - G C - G C - G C - G G - C T A T T C C C C A C G A T + | | | | G G T G T G G G G G G C G + | | | T T C G C A C C T A G TAGC C - G C - G G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |