Sequence ID | >WENV170784051 |
Genome ID | MCHG01000004 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 540770 |
End posion on genome | 540697 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gaaaagcaat |
tRNA gene sequence |
GCGGACGTGGCTCAGTTGGTAGAGCATCACCTTGCCAAGGTGAGGGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
agaaggtctc |
Secondary structure (Cloverleaf model) | >WENV170784051 Gly GCC t TCgg agaaggtctc G - C C - G G - C G - C A - T C - G G - C T A T T G C C C A T G A G + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |