Sequence ID | >WENV170784058 |
Genome ID | MCHG01000004 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 48055 |
End posion on genome | 47980 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
aaggcggtct |
tRNA gene sequence |
GGGGCTATGGCGCAGTTGGTAGCGCGTCTCGTTCGCAATGAGAAGGTCAGGGGTTCGAAT |
Downstream region at tRNA end position |
atgtgatgac |
Secondary structure (Cloverleaf model) | >WENV170784058 Ala CGC t ACCA atgtgatgac G - C G - C G + T G - C C - G T - A A - T T A T T C C C C A T G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A G AGGTC T - A C - G T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |