Sequence ID | >WENV170784066 |
Genome ID | MCHG01000005 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 381287 |
End posion on genome | 381212 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gacgtcgtgc |
tRNA gene sequence |
GCCTGGATAGCTCAGCTGGTAGAGCAGTGGATTGAAAATCCACGTGTCGGTGGTTCGAAC |
Downstream region at tRNA end position |
ctcctcccta |
Secondary structure (Cloverleaf model) | >WENV170784066 Phe GAA c ACCA ctcctcccta G - C C - G C - G T - A G - C G - C A - T C A T C C G C C A C G A A | | + | | G T C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C T - A G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |