Sequence ID | >WENV170784067 |
Genome ID | MCHG01000005 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 377716 |
End posion on genome | 377640 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgttgatcgc |
tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGTTAGAGCGCCGGTTTGTGGAACCGGAGGTCCTCAGTTCAAG |
Downstream region at tRNA end position |
tcactcccac |
Secondary structure (Cloverleaf model) | >WENV170784067 His GTG c ACCA tcactcccac G + T C - G C - G G - C C - G C - G T - A C G T G A G T C A T G A A | | | | | A T C T C G C T C A G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C T - A T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |