Sequence ID | >WENV170784068 |
Genome ID | MCHG01000005 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 363714 |
End posion on genome | 363631 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aatgcgcgct |
tRNA gene sequence |
GGGGGAATGTCCCGAGTGGCAAAGGGGGGGGACTGTAAATCCCCTGCGTAAGCTTCGAAG |
Downstream region at tRNA end position |
cgcgcatttt |
Secondary structure (Cloverleaf model) | >WENV170784068 Tyr GTA t ACCA cgcgcatttt G - C G - C G - C G - C G - C A - T A - T T G T C T T C C A G A G G | | | | | G T C C C T G A A G G C G | | + T T G A G G G C A A G TGCGTAAGCTTC G - C G - C G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |