Sequence ID | >WENV170784073 |
Genome ID | MCHG01000005 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 107229 |
End posion on genome | 107153 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tccatcggtt |
tRNA gene sequence |
CGGGGTGTAGCGCAGCCTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tggatttagc |
Secondary structure (Cloverleaf model) | >WENV170784073 Pro TGG t ACCA tggatttagc C - G G - C G - C G - C G - C T + G G - C T A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |