Sequence ID | >WENV170784075 |
Genome ID | MCHG01000005 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 79060 |
End posion on genome | 78984 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cacgtcatga |
tRNA gene sequence |
GGGCGGCTAGCTCAGCTGGTCAGAGCATCTCGTTTACACCGAGAGGGTCGGCGGTTCGAA |
Downstream region at tRNA end position |
ctttaagtca |
Secondary structure (Cloverleaf model) | >WENV170784075 Val TAC a ACCA ctttaagtca G + T G - C G - C C - G G - C G - C C - G C A T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T C A A GGGTC T - A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |