Sequence ID | >WENV170784090 |
Genome ID | MCHG01000011 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 156882 |
End posion on genome | 156807 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
acgacggtac |
tRNA gene sequence |
GGGTGATTAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCCACAGTTCGAAC |
Downstream region at tRNA end position |
tcgtctctct |
Secondary structure (Cloverleaf model) | >WENV170784090 Lys CTT c ACCA tcgtctctct G - C G - C G - C T - A G - C A - T T - A C A T G T G T C A T G A A | | | | | G T C T C G C A C A G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |