Sequence ID | >WENV170784091 |
Genome ID | MCHG01000012 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 44515 |
End posion on genome | 44441 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
caaacccggc |
tRNA gene sequence |
GGACGCGTAGCTCAGCGGGAGAGCACCTCGTTGACATCGAGGGGGTCACAGGTTCAATCC |
Downstream region at tRNA end position |
ttcttttcag |
Secondary structure (Cloverleaf model) | >WENV170784091 Val GAC c ACCA ttcttttcag G - C G - C A - T C - G G + T C - G G - C C T T T G T C C A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |