Sequence ID | >WENV170784095 |
Genome ID | MCHG01000014 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 135571 |
End posion on genome | 135646 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
actatcattt |
tRNA gene sequence |
GCCTCGGTAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
cttacagcct |
Secondary structure (Cloverleaf model) | >WENV170784095 Phe GAA t ACCA cttacagcct G - C C - G C - G T - A C - G G + T G - C T T T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |