Sequence ID | >WENV170784102 |
Genome ID | MCHG01000016 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 29380 |
End posion on genome | 29456 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ggaggggaat |
tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTTAGAGTGCCGGCCTGTCACGCCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
ttttcttcac |
Secondary structure (Cloverleaf model) | >WENV170784102 Asp GTC t GCCA ttttcttcac G - C C - G G - C G + T G - C T - A G - C T G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |