Sequence ID | >WENV170784103 |
Genome ID | MCHG01000016 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 40316 |
End posion on genome | 40405 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ggctcgatgt |
tRNA gene sequence |
GGAAGTGTGGCCGAGTGGTTTAAGGCACTGGTCTTGAAAACCAGCGACGGTGAGAGCCGT |
Downstream region at tRNA end position |
ctcccactcg |
Secondary structure (Cloverleaf model) | >WENV170784103 Ser TGA t GCCA ctcccactcg G - C G - C A - T A - T G - C T + G G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGACGGTGAGAGCCGTCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |