Sequence ID | >WENV170784111 |
Genome ID | MCHG01000017 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 20655 |
End posion on genome | 20729 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gctttaacat |
tRNA gene sequence |
GCGGGTGTAACTCAGTGGTAGAGTGTCACCTTGCCAAGGTGAAAGTCGCGAGTTCGAATC |
Downstream region at tRNA end position |
tatactttta |
Secondary structure (Cloverleaf model) | >WENV170784111 Gly GCC t TCCA tatactttta G - C C - G G - C G - C G - C T - A G - C T A T T G C T C A G A A + | | | | G T C T C A G C G A G C G | | | | T T G G A G T T A G AAGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |