Sequence ID | >WENV170784124 |
Genome ID | MCHG01000022 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 110629 |
End posion on genome | 110704 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
cctgtcggtc |
tRNA gene sequence |
GGGGCCGTAGCTCAGTTGGTAGAGCGCGTCGTTCGCAATGACGAGGTCAGGGGTTCGATT |
Downstream region at tRNA end position |
aggcattttc |
Secondary structure (Cloverleaf model) | >WENV170784124 Ala CGC c ACCA aggcattttc G - C G - C G + T G - C C - G C - G G - C T T T T C C C C A T G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C T A G AGGTC C - G G - C T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |