Sequence ID | >WENV170784131 |
Genome ID | MCHG01000030 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 114151 |
End posion on genome | 114077 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ttactgcgct |
tRNA gene sequence |
GGACGCGTAGCTCAGCGGGAGAGCACCTCGTTCACACCGAGGGGGTCACAGGTTCAATCC |
Downstream region at tRNA end position |
tccttttcaa |
Secondary structure (Cloverleaf model) | >WENV170784131 Val CAC t ACCA tccttttcaa G - C G - C A - T C - G G - C C - G G - C C T T T G T C C A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |