Sequence ID | >WENV170784141 |
Genome ID | MCHG01000035 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 112257 |
End posion on genome | 112182 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tattgttctc |
tRNA gene sequence |
AGGGGTATAGCTCAACTGGTAGAGTAGCGGTCTCCAAAACCGTTGGTTGAGGGTTCAAGT |
Downstream region at tRNA end position |
atcatattaa |
Secondary structure (Cloverleaf model) | >WENV170784141 Trp CCA c GCCA atcatattaa A - T G - C G - C G - C G - C T + G A - T T G T C T T C C A C A A A | | + | | A T C T C G G A G G G C G | | | + T T G G A G T T A A TGGTT G + T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |