Sequence ID | >WENV170784142 |
Genome ID | MCHG01000036 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 38625 |
End posion on genome | 38549 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aaggcaatgc |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCACCAGACTACGAATCTGGGGGTCAGGAGTTCGAA |
Downstream region at tRNA end position |
cttcggttta |
Secondary structure (Cloverleaf model) | >WENV170784142 Arg ACG c GCCA cttcggttta G - C C - G A - T C - G C - G C - G G - C T A T T T C T C A C G A A | + | | | G T C T C G A G G A G C G | | | | T T G G A G C A T A A GGGTC C - G C - G A - T G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |