Sequence ID | >WENV170784145 |
Genome ID | MCHG01000041 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 71929 |
End posion on genome | 71855 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccaccatcaa |
tRNA gene sequence |
GGCCCGTTGGTCAAGCGGTCAAGACATCGCCCTTTCACGGCGGTAACGGGGGTTCGATTC |
Downstream region at tRNA end position |
ttatagtttc |
Secondary structure (Cloverleaf model) | >WENV170784145 Glu TTC a ACCA ttatagtttc G - C G + T C - G C - G C - G G - C T - A T T T C C C C C A C G A G | | | | | G G A C T G G G G G G C G | | | T T T A G A C C A A TAAC T + G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |