Sequence ID | >WENV170784153 |
Genome ID | MCHG01000047 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 79454 |
End posion on genome | 79368 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cgcttgttac |
tRNA gene sequence |
GCGGTCGTGGCGAAACTGGCAGACGCGCTAGATTCAGGTTCTAGTGCTCGCAAGGGCATG |
Downstream region at tRNA end position |
ctttaaaaat |
Secondary structure (Cloverleaf model) | >WENV170784153 Leu CAG c ACCA ctttaaaaat G - C C - G G - C G - C T - A C - G G - C T G T T C T C C A C A A G + | | | | A T A G C G G G A G G C G | | | T T G A C G C C A G G TGCTCGCAAGGGCAT C - G T - A A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |