Sequence ID | >WENV170784161 |
Genome ID | MCHG01000057 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 36320 |
End posion on genome | 36396 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
caaagaatgt |
tRNA gene sequence |
GCGCCCCTAGCTCAGTTGGTTAGAGCATCTGACTTTTAATCAGAGGGTCCTCGGTTCGAG |
Downstream region at tRNA end position |
atttccccta |
Secondary structure (Cloverleaf model) | >WENV170784161 Lys TTT t ACCA atttccccta G + T C - G G - C C - G C - G C - G C - G C G T G A G C C A T G A A | | | | | G T C T C G C T C G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |