Sequence ID | >WENV170784171 |
Genome ID | MCHG01000083 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 13880 |
End posion on genome | 13806 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aatcaatatt |
tRNA gene sequence |
GGCTCCATGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTTACAGGGGTTCAAATC |
Downstream region at tRNA end position |
ttaaaaaatg |
Secondary structure (Cloverleaf model) | >WENV170784171 Glu TTC t ACCA ttaaaaaatg G - C G + T C - G T - A C - G C - G A - T T A T T C C C C A C G A G | | | | | A G A C T G A G G G G C G | | | T T T A G A C T A A TTAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |