Sequence ID | >WENV170784184 |
Genome ID | MCHG01000089 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 60954 |
End posion on genome | 60878 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cagctaaaac |
tRNA gene sequence |
GGGCCATTAGCTCAGTCGGCTAGAGCACCTGACTTTTAATCAGGGTGTCCCGCGTTCGAG |
Downstream region at tRNA end position |
aaaatgcatt |
Secondary structure (Cloverleaf model) | >WENV170784184 Lys TTT c ACCA aaaatgcatt G - C G - C G - C C - G C - G A - T T - A T G T G G C G C A T G A A | | | | | G C C T C G C C G C G C G | | | | T T G G A G C C T A A GTGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |