Sequence ID | >WENV170784189 |
Genome ID | MCHG01000102 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 33061 |
End posion on genome | 32986 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cagttgaaat |
tRNA gene sequence |
TCCTCAATAGCTCAGTTGGTAGAGCATGCGGCTGTTAACCGCAGGGTCGTAGGTTCGAGT |
Downstream region at tRNA end position |
tttatttgga |
Secondary structure (Cloverleaf model) | >WENV170784189 Asn GTT t GCCA tttatttgga T - A C - G C - G T + G C - G A - T A - T T G T C A T C C A T G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC T - A G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |