Sequence ID | >WENV170784195 |
Genome ID | MCHG01000107 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 34089 |
End posion on genome | 34012 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
attgtctcat |
tRNA gene sequence |
GGGCGCGTGGCCTAGCCCGGATATGGCGGCAGCCTCCTAAGCTGTAAATCGGGGGTTCGA |
Downstream region at tRNA end position |
atttcttttt |
Secondary structure (Cloverleaf model) | >WENV170784195 Arg CCT t GCTA atttcttttt G - C G - C G - C C - G G - C C - G G - C T A T T T C C C A C C G A G + + | | | G C T C C G G G G G G C G | | | T T G T G G C A T A G AAATC G + T C - G A - T G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |