Sequence ID | >WENV170784204 |
Genome ID | MCHG01000114 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 606 |
End posion on genome | 682 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ataaacaact |
tRNA gene sequence |
GGGCCCGTAGCTCAGTCCGGCAGAGCGTCTGGCTTTTAACCAGACGGCCTAGGGTTCAAA |
Downstream region at tRNA end position |
tattcttaat |
Secondary structure (Cloverleaf model) | >WENV170784204 Lys TTT t GCCA tattcttaat G - C G - C G - C C - G C - G C - G G - C T A T A T C C C A T G A A | | | | | A C C T C G T A G G G C C | | | | T T G G A G C G C A G CGGCC T - A C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |