Sequence ID | >WENV170784206 |
Genome ID | MCHG01000118 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 1818 |
End posion on genome | 1742 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tcactaatta |
tRNA gene sequence |
CGAGGTGTAGCGCAGTTTGGTAGCGCACATGGTTTGGGACCATGGGGCCGAAGGTTCAAA |
Downstream region at tRNA end position |
ttttattaaa |
Secondary structure (Cloverleaf model) | >WENV170784206 Pro TGG a ACCA ttttattaaa C - G G - C A - T G - C G - C T - A G - C T A T T T T C C A T G A A + | | | | A T C G C G G A A G G C T | | | | T T G G C G C G T A A GGGCC C - G A - T T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |