Sequence ID | >WENV170784217 |
Genome ID | MCHG01000134 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 9480 |
End posion on genome | 9556 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aataatgcgt |
tRNA gene sequence |
GGGCTCGTAGCTTAGTCAGGCAGAGCGATGGACTCTTAATCCATAGGTCGGGGGTTCAAA |
Downstream region at tRNA end position |
atctttttat |
Secondary structure (Cloverleaf model) | >WENV170784217 Lys CTT t GCTA atctttttat G - C G - C G - C C - G T - A C - G G - C T A T T T C C C A T G A A + + | | | A C T T C G G G G G G C A + | | | T T G G A G C G C A G AGGTC A - T T - A G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |