Sequence ID | >WENV170784219 |
Genome ID | MCHG01000147 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 21453 |
End posion on genome | 21380 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ctggtcctgc |
tRNA gene sequence |
TGGGGAATGGTGTAATGGTAACACTACGGTTTTTGGTACCGTCATTCTAGGTTCGAGTCC |
Downstream region at tRNA end position |
ccgatgcata |
Secondary structure (Cloverleaf model) | >WENV170784219 Gln TTG c GCCA ccgatgcata T - A G - C G - C G - C G - C A - T A - T T G T G A T C C A A A G | | | | | G T T G T G C T A G G C G | | | | T T G A C A C T A T CATT A - T C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |