Sequence ID | >WENV170784228 |
Genome ID | MCHG01000167 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 32417 |
End posion on genome | 32504 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaaacaagat |
tRNA gene sequence |
GCGAGGGTTGCCCAGCCAGGTCAAAGGCGATAGGTTGAGGGCCTATTCTTGTAGGAGTTC |
Downstream region at tRNA end position |
agtttcttaa |
Secondary structure (Cloverleaf model) | >WENV170784228 Leu GAG t ACCA agtttcttaa G - C C - G G - C A - T G - C G - C G - C T A T T A C C C A C C G A T + | | | | G A C C C G G T G G G C G | | | T T G A G G C T C A A G TCTTGTAGGAGTTC A - T T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |