Sequence ID | >WENV170784235 |
Genome ID | MCHG01000181 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 29113 |
End posion on genome | 29039 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttatttccct |
tRNA gene sequence |
GGCGGCATAGCCAAGTGGTAAGGCAGAGGTCTGCAAAACCTCTATTCCTCAGTTCAAATC |
Downstream region at tRNA end position |
aacaattcat |
Secondary structure (Cloverleaf model) | >WENV170784235 Cys GCA t TCCA aacaattcat G - C G - C C - G G - C G - C C - G A - T T A T G A G T C A G A A | | | | | A T A C C G C T C A G C G | | | T T G A G G C T A A TATTC G - C A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |