Sequence ID | >WENV170784237 |
Genome ID | MCHG01000181 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 28936 |
End posion on genome | 28860 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ggcaccatat |
tRNA gene sequence |
GGGTTTGTAGCTCAGCTGGTTAGAGTACCGCGTTGACATCGCGGGGGTCGGAGGTTCGAG |
Downstream region at tRNA end position |
taaggaacat |
Secondary structure (Cloverleaf model) | >WENV170784237 Val GAC t ACCA taaggaacat G - C G - C G - C T - A T - A T - A G - C T G T T C T C C A C G A A + | | | | G T C T C G G G A G G C G | | | + T T G G A G T T T A A GGGTC C - G C - G G - C C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |