Sequence ID | >WENV170784242 |
Genome ID | MCHG01000199 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 22702 |
End posion on genome | 22631 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tttcacatga |
tRNA gene sequence |
AGGTCTGTGGTGTAGTGGATATCACTGGAGCCTCCGGAGCTCCGAATCTGGGTTCGATTC |
Downstream region at tRNA end position |
ctcaaaacgg |
Secondary structure (Cloverleaf model) | >WENV170784242 Arg CCG a Gttg ctcaaaacgg A - T G - C G - C T - A C - G T - A G - C T T T G A C C C A T G A G | | | | | G G T G T G C T G G G C G | | | T T A T C A C T A T GAAT G - C G - C A - T G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |