Sequence ID | >WENV170784247 |
Genome ID | MCHG01000221 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 4179 |
End posion on genome | 4107 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
agactaatat |
tRNA gene sequence |
GGGCCGGTAGATCAGGGGTAGATCGCTACCTTGGCATGGTAGAGGCCTCGGGTTCAATTC |
Downstream region at tRNA end position |
aaaaagattt |
Secondary structure (Cloverleaf model) | >WENV170784247 Ala GGC t ACtt aaaaagattt G - C G - C G + T C - G C - G G - C G - C T T T A G C C C A G A A | | | | | A G C T A G T C G G G C G | | | | T T G G A T C T A G AGGCC C - G T - A A - T C - G C - G T T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |