Sequence ID | >WENV170784248 |
Genome ID | MCHG01000226 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 1939 |
End posion on genome | 2014 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tattacccgc |
tRNA gene sequence |
GGGCCTCTAGCTCAGTTGGTAGAGCAAAGGACTTTTAATCCTTGGGTCGTCGGTTCGAGC |
Downstream region at tRNA end position |
ttgcgcctct |
Secondary structure (Cloverleaf model) | >WENV170784248 Lys TTT c ACCC ttgcgcctct G - C G - C G - C C - G C - G T + G C - G C G T C A G C C A T G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A A GGGTC A - T A - T G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |