Sequence ID | >WENV170784257 |
Genome ID | MCHG01000243 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 17958 |
End posion on genome | 17884 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gacccctgtg |
tRNA gene sequence |
GCCGGGGTAGGGTAGAGGTTATCCTGTGGCCCTGTGGAGGCTACGATCCGAGTTCGATTC |
Downstream region at tRNA end position |
aataattttt |
Secondary structure (Cloverleaf model) | >WENV170784257 His GTG g CCTA aataattttt G - C C - G C - G G - C G - C G - C G + T T T T G G C T C A A G A A | | | | | G G T G G G C C G A G C G | | + T T T T C C T T A G CGAT T - A G + T G - C C - G C - G C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |