Sequence ID | >WENV170784259 |
Genome ID | MCHG01000259 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 10908 |
End posion on genome | 10995 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tttccaaccT |
tRNA gene sequence |
GCTGAGGTAGCCCAGTGGTCTACGGCGCCGGTCTTGAAAACCGGTAGTGCTCACGCGCTA |
Downstream region at tRNA end position |
ttcaattctt |
Secondary structure (Cloverleaf model) | >WENV170784259 Ser TGA T GTaa ttcaattctt G - C C - G T - A G - C A - T G - C G - C T A T C C C T C A T G A A | | | | | G G C C C G G G G A G C G | | | T T T C G G C C T A G TAGTGCTCACGCGCTAC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |