Sequence ID | >WENV170784265 |
Genome ID | MCHG01000297 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 6054 |
End posion on genome | 6130 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cctagaactg |
tRNA gene sequence |
GCGCCTGTAGCTCAGTTGGATAGAGCATCTGCCTTCTAAGCAGGTTGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
atatttaaaa |
Secondary structure (Cloverleaf model) | >WENV170784265 Arg TCT g ACCA atatttaaaa G - C C - G G - C C - G C - G T - A G - C T A T C T C T C A T G A A | + | + | G T C T C G G G G G G C G | | | | T T G G A G C A T A A TTGTC T + G C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |