Sequence ID | >WENV170784272 |
Genome ID | MCHG01000329 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 10299 |
End posion on genome | 10225 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
atatctacct |
tRNA gene sequence |
GCCCAGGTAGCTCAGTGGGAGAGCGCTGCCCTGAAGAGGCAGTTGTCCCCGGTTCGAATC |
Downstream region at tRNA end position |
tatcacatca |
Secondary structure (Cloverleaf model) | >WENV170784272 Phe GAA t ACCA tatcacatca G - C C - G C - G C - G A - T G - C G + T T A T G G G C C A G A A | | | | | G T C T C G C C C G G C G | | | | T T G G A G C G A G TTGTC C - G T - A G - C C - G C - G C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |