Sequence ID | >WENV170784280 |
Genome ID | MCHG01000382 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 9265 |
End posion on genome | 9337 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
aaatcatcga |
tRNA gene sequence |
AGCCCGGTAGTGTAGTGGTCAATCATGCGGGACTCTGGATCCTGCAACCTCGGTTCGAAT |
Downstream region at tRNA end position |
gcatatcagt |
Secondary structure (Cloverleaf model) | >WENV170784280 Gln CTG a Atat gcatatcagt A - T G - C C - G C - G C - G G - C G - C T A T G T G C C A T G A A | | | | G G T G T G C T C G G C G | | + T T T T C A T C A A G CAAC C - G G + T G - C G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |