Sequence ID | >WENV170784288 |
Genome ID | MCHG01000471 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 7343 |
End posion on genome | 7416 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
gctcgctcgT |
tRNA gene sequence |
GTCCCGATAGGGTAGTGGATATCCTTGAGGCCTGCGGAGCCTTAGACCTGAGTTCAAGTC |
Downstream region at tRNA end position |
attttattat |
Secondary structure (Cloverleaf model) | >WENV170784288 Arg GCG T GTaa attttattat G - C T - A C - G C - G C - G G - C A - T T G T G A C T C A T G A A | | | | | A G T G G G C T G A G C G | | + T T A T C C T T A T AGAC G + T A - T G - C G - C C - G C A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |