Sequence ID | >WENV170784308 |
Genome ID | MCHG01000706 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 2643 |
End posion on genome | 2719 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gatggcgatc |
tRNA gene sequence |
CGGGGCGTAGCTCAGCTTGGTAGAGCGCTCGGTTTGGGACCGAGAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
tcacccccca |
Secondary structure (Cloverleaf model) | >WENV170784308 Pro TGG c ACCA tcacccccca C - G G - C G - C G - C G - C C - G G - C T A T T G T C C A C G A A + | | | | G T C T C G G C A G G C T | | | | T T G G A G C G T A G AGGTC C - G T - A C - G G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |