Sequence ID | >WENV170784309 |
Genome ID | MCHG01000706 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 2469 |
End posion on genome | 2396 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gacgggccct |
tRNA gene sequence |
GGGGATGTAGCTCAATGGTAGAGCCTCAGTTTTCCAAACTGATGGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
cttcagtcac |
Secondary structure (Cloverleaf model) | >WENV170784309 Gly TCC t TCCA cttcagtcac G - C G - C G - C G - C A - T T - A G - C T T T T G C C C A A A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A C TGGC T - A C - G A - T G - C T - A T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |