Sequence ID | >WENV170784310 |
Genome ID | MCHG01000712 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 6099 |
End posion on genome | 6173 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tgcccaatag |
tRNA gene sequence |
GGGGATATAGCTCAGTTGGTTAGAGCGCTTCACTGATAATGAAGAGGTCCCAGGTTCAAA |
Downstream region at tRNA end position |
gcgacctcaa |
Secondary structure (Cloverleaf model) | >WENV170784310 Ile GAT g ACgt gcgacctcaa G - C G - C G - C G - C A - T T - A A - T T A T G G C C C A T G A A | | | | A T C T C G C C A G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A T - A C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |