Sequence ID | >WENV170784311 |
Genome ID | MCHG01000712 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 6210 |
End posion on genome | 6283 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tgtgattcgc |
tRNA gene sequence |
GGGGCCATAGCTCAATTGGTAGAGCGCCTGCTTTGCAAGCAGGAGGTCCGGGGTTCGATT |
Downstream region at tRNA end position |
atgacagacg |
Secondary structure (Cloverleaf model) | >WENV170784311 Ala TGC c ACac atgacagacg G - C G - C G + T G - C C - G C - G A - T T T T G C C C C A T A A A | | | | | G T C T C G C G G G G C G | | | | T T G G A G C T A G AGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |