Sequence ID | >WENV170784312 |
Genome ID | MCHG01000730 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 3269 |
End posion on genome | 3354 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tcgcgaaccg |
tRNA gene sequence |
GGAGGGCTGTCCGAGCGGCCGATGGAGCCAGTCTTGAAAACTGGTGGGCAGAAATGTCTC |
Downstream region at tRNA end position |
tgcgaggtgt |
Secondary structure (Cloverleaf model) | >WENV170784312 Ser TGA g GCat tgcgaggtgt G - C G - C A - T G - C G - C G - C C - G T A T C A C C C A C G A G | | | | | G G G C C T G T G G G C G + | | | T T C T G G A C G A G TGGGCAGAAATGTCTC C - G C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |