Sequence ID | >WENV170784314 |
Genome ID | MCHG01000754 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 3639 |
End posion on genome | 3714 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ccgcacagtt |
tRNA gene sequence |
GGGCGATTGGCGCAGTTGGTAGCGCGCTTCCTTCACACGGAAGAGGTCATCGGTTCGAGT |
Downstream region at tRNA end position |
aataagcccc |
Secondary structure (Cloverleaf model) | >WENV170784314 Val CAC t ACCG aataagcccc G - C G - C G - C C - G G - C A - T T - A T G T T G G C C A T G A G | + | | | G T C G C G A T C G G C G | | | | T T G G C G C T A G AGGTC C - G T - A T - A C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |