Sequence ID | >WENV170784316 |
Genome ID | MCHG01000754 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 3359 |
End posion on genome | 3286 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gtgaacccag |
tRNA gene sequence |
GGTGGATTGGCCGAGAGGCGAGGCAGCGGCCTGCAAAGCCGTATACACGGGTTCGAATCC |
Downstream region at tRNA end position |
ttctgtggaa |
Secondary structure (Cloverleaf model) | >WENV170784316 Cys GCA g TCCA ttctgtggaa G - C G - C T - A G - C G - C A - T T - A T A T T G C C C A G A G | | | | | G A G C C G A C G G G C G | | | T T G A G G C C G A ATAC G + T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |